|
Peronophythora litchii Chen ex Ko et al is a fungal plant
pathogenthat cause downy blight of litchi ( Litchi chinensis
Sonn. ). Thispathogen caused serious disease of premature
fruit during the rainyseason by the rain and wind. It might can
be controlled the developmentof!this disease and decreased the
yield loss during the storage by rapiddetection. The
sporangiophore of Peronophythora litchii is similar tothe same
structure of Peronospora Cordax, and the lemon-shaped
sporagiumwith papillae of this fungus is similar to the
structure of Phytophthorade Bary which were observed by scanning
electron microscopy. The optimaltemperatures for the mycelial
growth of the fungus are between 22 ~ 28℃, and the limits were
below 4 ℃ and above 36 ℃. The suitable termsof the mycelial
growth are photoperoid, pH 4.5 ~ 8, and five percentageof CV8
juice medium. The symptoms of inoculated fruits with wound
andnon-wound which were both covered with whit
sporangia andsporangiophores were no differences. It was
supposed that the diseasecan developed in the field without
mechanical injury. Selected primerswere used to find specific
DNA markers of P. Litchii by using randomamplified
polymorphic DNA ( RAPD ). There were nine primers
couldamplify the specific patterning bands by RAPD. The
primer OPW-02 (5'TCGCAGGTTC3' ) amplified a distinct
fragment of 595 bp that wasspecific to P. litchii, and
cloned by pCRRII-TOPO vector. The insertedDNA fragment was
digested by EcoR I. The digested DNA fragment waslabeled
with non- isotope and named probe pR4, to be identified
inSouthern blotting analysis. There was specific signal to P.
litchii andthe same signal was not shown in Phytophthora spp.,
Pythium spp., andGeotrichum candidum. Five primers were
designed and synthesized by thesequence of the inserted
fragment: R4F7, R4MF245, R4MF258 are forwardprimers, and R4
R562, R4R592 are reverse primers. The primer pairsR4MF245
( 5'GCTCCAAGATGTTGGTTGGGATCGG3' ) and R4R562 (
5'GATCTACAGCACAGCCCAAAGAAGG3' ) could amplify a distinct
patterning band of 317bp that was specific to P. litchii by
polymerase chain reaction ( PCR ).The minimum amount of DNA from
P. litchii that could be detected by PCRwas 500 pg. And the
sensitivity can be raised to 50 pg of DNA from P.litchii by
using Southern blotting analysis with probe pR4. In summary,the
RAPD could be a very potential technique in using the specific
RAPDbands as genetic markers for identification of P.
litchii. Specificprimer pairs-R4MF245 and R4R562 could
detect the P. litchii by thetechnique of PCR and Southern
blotting analysis. We hope thesetechniques can detect the
disease of fruit and the soil in the fielddirectly in the
future. In advance, to understand the role of P. litchiiin
ecology, disease development, and genesis from oomyces.
|